The goal for this section was to mutate the chromoprotein amilCP, from the beautiful purple Acropora Millepora, to a variety of colors and then express the mutations in E.coli cells to create a pattern on an agar plate.
The first part of this 2 week assignment started solely in the computer. We needed to prepare and order the primers that could generate a variety of mutated amilCP expressing E.coli cells. We would do this using Gibson Assembly to insert our mutated gene into a plasmid that would then be transformed into electrocompetent E.coli cells.
To start the process I first imported the pUC 19 plasmid sequence from Addgene into Benchling. I then used the restriction enzyme PvuII to cut at two specific points in the DNA and identified the backbone. The backbone contains the origin of replication (ORI) and the antibiotic resistance (AmpR). Next step was to import the mUAV plasmid sequence into Benchling and identify several parts including the amilCP gene, RBS, promoter, and terminators. See below for each one highlighted in benchling.
PART A: IMPORTING AND IDENTIFYING
imported pUC19 plasmid sequence
pUC19 backbone
amilCP gene in Plasmid mUAV
RBS in Plasmid mUAV
Promoter in Plasmid mUAV
Terminators in Plasmid mUAV
Next we needed to find the mutation region, cagTGTCAGtac. This sequence can be edited to express different colors. I found this mutation sequence in the amilCP gene and developed a chart that decodes the codon table and converts it to colors of DNA sequences. The chart is based on an online codon table located HERE. Note that it's not exhaustive! Each amino acid sequence can be translated into several different nucleotide sequences.
Plasmid Encoded amilCP Variants, Liljeruhm, Josefine, et al.
Plasmid Encoded amilCP Variants, Liljeruhm, Josefine, et al.
Color to DNA Sequence Chart
Chromophore (CP) Mutation Sequence
Next came primer design, the tough part! Took me a couple of tries and a few sketches to get it. Essentially we needed to design four primers: an outer forward, outer reverse, inner forward (containing our mutation), and inner reverse. For each primer we looked at the primer sequence, primer length, melting temperature, GC clamp presence, GC content and secondary structures.
OUTER FORWARD PRIMER DESIGN
OUTER REVERSE PRIMER DESIGN
INNER REVERSE PRIMER DESIGN
INNER FORWARD PRIMER DESIGN
pUC19 -> 5' TTGGCCGATTCATTAATGCA 3' PRIMER LENGTH: 20 MELTING TEMPERATURE: 52.5C GC CLAMP: Yes, there are G's and C's within the last five bases from the 3' end and no more than 3 G's or C's. GC CONTENT: 40%
mUAV -> 5' tcggtctctatatgcaggtg 3' PRIMER LENGTH: 20 MELTING TEMPERATURE: 52.7C GC CLAMP: Yes, there are G's within the last five bases from the 3' end and no more than 3 G's or C's. GC CONTENT: 50%
pUC19 to mUAV therefore the forward primer design is 5' TTGGCCGATTCATTAATGCATCGGTCTCTATATGCAGGTG 3'
pUC19 -> 5' GGGCCTCTTCGCTATTACGC 3' PRIMER LENGTH: 20 MELTING TEMPERATURE: 57.4C GC CLAMP: Yes, there are C's & G's within the last five bases from the 3' end and no more than 3 G's or C's. GC CONTENT: 60%
mUAV -> 5' AGGGTCTCAATATGCAGGTG 3' PRIMER LENGTH: 20 MELTING TEMPERATURE: 53.4C GC CLAMP: Yes, there are G's within the last five bases from the 3' end and no more than 3 G's or C's. GC CONTENT: 50%
pUC19 to mUAV therefore the reverse primer design is 5' GGGCCTCTTCGCTATTACGCAGGGTCTCAATATGCAGGTG 3'
PRIMER LENGTH: 42 MELTING TEMPERATURE: 63.8C (Under 65C threshold) GC CLAMP: Yes, there are C's and no more than 3 C's or G's GC CONTENT: 40.5%
pUC19 outer forward and outer reverse primer locations
amilCP outer forward outer reverse primer locations
PRIMER LENGTH: 24 MELTING TEMPERATURE: 53.9C GC CLAMP:Yes, there are G's and C's in the last five bases from the 3' end and no more than 3 G's or C's. GC CONTENT: 41.67%
mUAV -> 5' CTGTGGTGATAAAATATCCCAAGC 3'
The color mutations I selected are fairly similar in sequence. As a result the TA recommended to use degenerate bases and I thought it would be a fun experiment. Degenerate bases means that more than one base is possible at a particular position. For example, specifying a IUPAC nucleotide code such as W can result in either an A or T base.
Updated Inner Forward Primers:
Blue | Purple Mix: GATATTTTATCACCACAGGTTMWTTACGGAAGCATACCATTC Orange | Pink Mix: GATATTTTATCACCACAGGTTKCTTACGGAAGCATACCATTC
The next part involved using the OpenTrons robot to isolate the pUC19 backbone by restriction digest, using PCR to amplify the mutated amilCP fragments, using Gibson assembly to assemble the fragments, and finally transforming into E.coli cells with heat shock. We also needed to design a pattern that will be made with our colorful, transformed E.coli cells! The process involved a variety of charts calculating concentrations. I made a little booklet to help me organized the different volumes and docking locations for the various components in the wells.
Next step was to come up with a design to test. I thought it would be interesting to test some phyllotaxis patterns which is based on Fibonacci numbers. I used rhino 3D to create some initial patterns and then coded the final design into the google Colab notebook provided by the TA to simulate a possible (optimistic) result. After a little back and forth I also updated the design to prevent smudging (320uL reduced to 160uL) and more smoothly transition between the two color mixes. At the moment I am thinking of drawing the pattern at first with only one color mix per plate and then using a third plate to test the two different color mixes simultaneously.
Design sketches of patterns created in rhino 3D with Grasshopper
Final degenerate base color mutations
OpenTrons thermocycler closing for PCR
Volume Calculations
PART B: REMOTE CLONING
Version 1 and 2 of the pattern code simulation in google Colab
As of March 30th I've completed parts A and B on the OpenTrons and will move on to parts C and D this week. Really excited to see the results even if they don't perfectly match the design idea :)
BPu MIX
OPI MIX
UPDATE 04/06:
After a memorable session with the OpenTrons OT-2 Robot (see below) we had some colored growth! All the desired colors were visible except orange, but there was also quite a bit of white growth. A few thoughts on why this may have happened. First, I tried using degenerate bases. While this can result in a combination to produce the desired colors it can also create combinations that do not correspond with color.
Liljeruhm, Josefine, et al. "Engineering a palette of eukaryotic chromoproteins for bacterial synthetic biology." Journal of biological engineering 12.1 (2018): 1-10.